zgc:158852

Ensembl ID:
ENSDARG00000071808
ZFIN ID:
ZDB-GENE-070112-972
Description:
serine protease inhibitor Kazal-type 2 [Source:RefSeq peptide;Acc:NP_001185680]
Human Orthologue:
SPINK2
Human Description:
serine peptidase inhibitor, Kazal type 2 (acrosin-trypsin inhibitor) [Source:HGNC Symbol;Acc:11245]
Mouse Orthologue:
Spink2
Mouse Description:
serine peptidase inhibitor, Kazal type 2 Gene [Source:MGI Symbol;Acc:MGI:1917232]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22453 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22453
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106474 Essential Splice Site 63 77 3 4
Genomic Location (Zv9):
Chromosome 14 (position 19056338)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 14850791
GRCz11 14 15156354
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGATGGATTAACATACTCCAATGAGTGCATGCTGTGTATGGAAATTTTG[T/C]AAGTAGTAGGCCTAACTTAAGTTTGATATTTTTAGTCCTCATCCACTTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link