si:dkey-37o8.1

Ensembl ID:
ENSDARG00000071727
ZFIN ID:
ZDB-GENE-030131-5667
Description:
eukaryotic translation elongation factor 1 alpha [Source:RefSeq peptide;Acc:NP_001157466]
Human Orthologues:
EEF1A1, EEF1A2
Human Descriptions:
eukaryotic translation elongation factor 1 alpha 1 [Source:HGNC Symbol;Acc:3189]
eukaryotic translation elongation factor 1 alpha 2 [Source:HGNC Symbol;Acc:3192]
Mouse Orthologues:
Eef1a1, Eef1a2
Mouse Descriptions:
eukaryotic translation elongation factor 1 alpha 1 Gene [Source:MGI Symbol;Acc:MGI:1096881]
eukaryotic translation elongation factor 1 alpha 2 Gene [Source:MGI Symbol;Acc:MGI:1096317]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12176 Nonsense Available for shipment Available now
sa37833 Nonsense Available for shipment Available now
sa24453 Nonsense Available for shipment Available now
sa8935 Essential Splice Site Mutation detected in F1 DNA During 2018
sa37834 Nonsense Available for shipment Available now
sa14507 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12176
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106272 Nonsense 16 483 1 7
Genomic Location (Zv9):
Chromosome 24 (position 10670947)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 10758350
GRCz11 24 10898717
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGTCTGAAGTCACAAGAASAACAAAGAGTGTATCTRAAATTTGGTAGYT[T/A]GGAGGGTGTAAAACGWGTAATTTACCAAATGGCAAAAGAAAGGATTCATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37833
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106272 Nonsense 87 483 2 7
Genomic Location (Zv9):
Chromosome 24 (position 10671244)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 10758647
GRCz11 24 10899014
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTCTTTAAGATGGGAAAGAGTTCCTTCAAGTATGCCTGGGTTCTGGAC[A/T]AACTGAAAGCGGAGAGGGAACGTGGGATCACGATTGACATTTCCCTGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24453
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106272 Nonsense 110 483 2 7
Genomic Location (Zv9):
Chromosome 24 (position 10671315)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 10758718
GRCz11 24 10899085
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTGGGATCACGATTGACATTTCCCTGCTGAAATTCAACACTCAGAAGTA[C/A]ACCTTTACCATAATCGATGCACCTGGTCATCGTGATTTCATTAAAAACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8935
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106272 Essential Splice Site 134 483 3 7
Genomic Location (Zv9):
Chromosome 24 (position 10671660)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 10759063
GRCz11 24 10899430
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCASCTAATTGTAGTTGACCTAAACCCGTTTTRTTTGTNTGNNTTTTCTT[A/T]GGCTGATGCTGCTCTGCTGATCGTCTCTGCAGCAAAGGGTGAATTTGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37834
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106272 Nonsense 171 483 3 7
Genomic Location (Zv9):
Chromosome 24 (position 10671773)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 10759176
GRCz11 24 10899543
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAACGGTCAGACAAGAGAACATGCTCTACTGGCGTACACTCTTGGGGTC[A/T]AACAGCTTGTAGTTTGTGTGAACAAAATGGACCTGACAGAGCCACCATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14507
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106272 Nonsense 239 483 4 7
Genomic Location (Zv9):
Chromosome 24 (position 10672349)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 10759752
GRCz11 24 10900119
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGATTCTAATTGTTTGTACTCTTCTCTCAGATGCAATGGTTTAAAGGGT[G/A]GAAGCTCAAGAGAAAAGAAGGCCACTGTCATGGCCGAACCTTGTTGGAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link