zgc:174919

Ensembl ID:
ENSDARG00000071725
ZFIN ID:
ZDB-GENE-080220-12
Description:
Zgc:174919 protein [Source:UniProtKB/TrEMBL;Acc:A9JRU3]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43747 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa43747
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106278 Nonsense 220 263 4 4
Genomic Location (Zv9):
Chromosome 22 (position 1987147)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 2728237
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACATGTCCTCAGTGCGGGAAGAGTTTCAGACACTCGTCATCCTTTACT[C/T]AACACATGATGATCCACACTGGAGAGAAAACGCACACCTGTGATCACTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link