zgc:66433

Ensembl ID:
ENSDARG00000071697
ZFIN ID:
ZDB-GENE-030131-9832
Description:
hypothetical protein LOC321250 [Source:RefSeq peptide;Acc:NP_954967]
Human Orthologue:
KIAA1211
Human Description:
KIAA1211 [Source:HGNC Symbol;Acc:29219]
Mouse Orthologue:
C530008M17Rik
Mouse Description:
RIKEN cDNA C530008M17 gene Gene [Source:MGI Symbol;Acc:MGI:2444817]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa909 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa909
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106198 Nonsense 765 998 10 13
ENSDART00000106212 Nonsense 758 991 11 14
ENSDART00000135907   None 76 None 3
ENSDART00000144736   None 174 None 5
ENSDART00000148204   None 56 None 4

The following transcripts of ENSDARG00000071697 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 21996023)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 20697511
GRCz11 14 20994756
KASP Assay ID:
554-0816.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACCAGAGTCACAGACTGAAGATACTAATGTTTTGTCTCCACAAACAACT[C/T]AAGTCATCGTTCCCRTCCTTGAAGAGCGACCCAAACCAGCCCGCACTCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link