Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
NDC80_DANRE
- Ensembl ID:
- ENSDARG00000071694
- Description:
- Kinetochore protein NDC80 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q6DRJ7]
- Human Orthologue:
- NDC80
- Human Description:
- NDC80 homolog, kinetochore complex component (S. cerevisiae) [Source:HGNC Symbol;Acc:16909]
- Mouse Orthologue:
- Ndc80
- Mouse Description:
- NDC80 homolog, kinetochore complex component (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1914302
Alleles
There are 5 alleles of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa22044 | Nonsense | Available for shipment | Available now |
| sa41971 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
| sa14319 | Essential Splice Site | Available for shipment | Available now |
| sa38875 | Nonsense | Mutation detected in F1 DNA | During 2018 |
| sa16762 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa22044
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000007335 | Nonsense | 156 | 632 | 5 | 17 |
| ENSDART00000112640 | Nonsense | 156 | 608 | 5 | 18 |
The following genes are also affected by this mutation:
- Genomic Location (Zv9):
- Chromosome 12 (position 11441918)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 10324989 GRCz11 12 10362832 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AATGCCTACTGCCAAAGTGGAGGAAGAGATCCCAAGAATGCTCAAAGATT[T/A]GGGGTAATCAATATTATTTTATCACTACACCCTGTACAATTTACAGTAGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa41971
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000007335 | Essential Splice Site | 221 | 632 | 7 | 17 |
| ENSDART00000112640 | Essential Splice Site | 221 | 608 | 7 | 18 |
- Genomic Location (Zv9):
- Chromosome 12 (position 11439962)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 10323033 GRCz11 12 10360876 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTTCTCAGATGAGCTGTGTGATTTAGAGGACCGAACAGAGTACAACAAGG[T/C]ATTCTATCAAACAACACCTCATCTTGTGCAGCACTTATTTTCTTATTTTA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa14319
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > C
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000007335 | Essential Splice Site | 513 | 632 | 14 | 17 |
| ENSDART00000112640 | Essential Splice Site | 489 | 608 | 15 | 18 |
- Genomic Location (Zv9):
- Chromosome 12 (position 11433812)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 10316883 GRCz11 12 10354726 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- YAAGGAACAGATTCGCAAAGTCGACCAGCAGCTGGAGAATGCCATGCAGG[T/C]AAAATACACCTCCACRGGGCGTTTGGGTTTTAAATGTAATATTAAAAAAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa38875
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000007335 | Nonsense | 557 | 632 | 15 | 17 |
| ENSDART00000112640 | Nonsense | 533 | 608 | 16 | 18 |
- Genomic Location (Zv9):
- Chromosome 12 (position 11433285)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 10316356 GRCz11 12 10354199 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TAATGCAGGGGATTGAGGAAGCTGAAGAGGAAGTCAAAGCTGCCCAACAA[C/T]AGTGAGAATCTCTTTTCCACTGTTTTTTTTTTTAATTCTGTTTCTTGTTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa16762
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000007335 | Nonsense | 632 | 632 | 17 | 17 |
| ENSDART00000112640 | Nonsense | 608 | 608 | 18 | 18 |
- Genomic Location (Zv9):
- Chromosome 12 (position 11432576)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 10315647 GRCz11 12 10353490 - KASP Assay ID:
- 2260-5040.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TAACCAGCTCACAGATCTGGWGGAAAACTTCATWAAGAAAGCCAACAGCT[T/A]GTAATGCTTRACTKTCCTGTTTTGTAAATACTKTTAYTATTAGACKAATT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
