uqcrc2

Ensembl ID:
ENSDARG00000071691
ZFIN ID:
ZDB-GENE-030131-1269
Description:
cytochrome b-c1 complex subunit 2, mitochondrial [Source:RefSeq peptide;Acc:NP_001001589]
Human Orthologue:
UQCRC2
Human Description:
ubiquinol-cytochrome c reductase core protein II [Source:HGNC Symbol;Acc:12586]
Mouse Orthologue:
Uqcrc2
Mouse Description:
ubiquinol cytochrome c reductase core protein 2 Gene [Source:MGI Symbol;Acc:MGI:1914253]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6237 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa6237
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014379 Essential Splice Site 112 454 4 14
Genomic Location (Zv9):
Chromosome 12 (position 11513739)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 10396810
GRCz11 12 10434653
KASP Assay ID:
554-5446.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCTTTTAGGATCTGCCGTGGTGTTGAGGCTGTTGGGGGAAGCTTAAGG[T/A]CAGTTTTTCAGTGTTACACAAAAACAANNTCTCCCTTTGGTGTATRTTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link