zfr2

Ensembl ID:
ENSDARG00000071683
ZFIN ID:
ZDB-GENE-070705-184
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A5WV30]
Human Orthologue:
ZFR2
Human Description:
zinc finger RNA binding protein 2 [Source:HGNC Symbol;Acc:29189]
Mouse Orthologue:
Zfr2
Mouse Description:
zinc finger RNA binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:2143792]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13178 Essential Splice Site Available for shipment Available now
sa37419 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa13178
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106164 Essential Splice Site 387 1004 6 19
ENSDART00000122341 Essential Splice Site 393 1010 6 19
ENSDART00000128916 Essential Splice Site 386 558 6 10

The following transcripts of ENSDARG00000071683 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 4725206)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 4699620
GRCz11 22 5083995
KASP Assay ID:
2261-6327.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGGCGCCGACGCTTACGCTGCGCACATTCGCGGATCCAAACACCAAAAG[G/A]TTTGTTTAATGTTTMATTTCAAYACTCTTCATCTYTTCAACATGTTTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37419
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106164 Nonsense 931 1004 18 19
ENSDART00000122341 Nonsense 937 1010 18 19
ENSDART00000128916   None 558 None 10

The following transcripts of ENSDARG00000071683 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 4699141)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 4673555
GRCz11 22 5057930
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATGGTCCTGGTCTTCTCGACCCATGTGAGAAAGGTCAGACAGATGCTT[T/A]GGGAACCATGTCGAAACAGGCTCGTGAAGACGTAACCGCTAACGCACAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link