zgc:153700

Ensembl ID:
ENSDARG00000071670
ZFIN ID:
ZDB-GENE-061027-176
Description:
Coiled-coil domain-containing protein 72 [Source:UniProtKB/Swiss-Prot;Acc:Q05AK9]
Human Orthologue:
CCDC72
Human Description:
coiled-coil domain containing 72 [Source:HGNC Symbol;Acc:26932]
Mouse Orthologue:
Ccdc72
Mouse Description:
coiled-coil domain containing 72 Gene [Source:MGI Symbol;Acc:MGI:1913417]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32368 Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa32368
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106141   None 64 None 4
ENSDART00000129942 Splice Site None 64 None 5

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 5593037)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 5639104
GRCz11 22 5668950
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCTTTTGTGGTCCTGTGTTACATATGAGTATGAAATCATTCTTGTTTA[C/T]ATCTTCCTCTGTCAAGCTGAAGGCAGTCTGGAAGTTGAACGGTTTCGCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link