smyd5

Ensembl ID:
ENSDARG00000071669
ZFIN ID:
ZDB-GENE-040912-39
Description:
SET and MYND domain-containing protein 5 [Source:RefSeq peptide;Acc:NP_001004614]
Human Orthologue:
SMYD5
Human Description:
SMYD family member 5 [Source:HGNC Symbol;Acc:16258]
Mouse Orthologue:
Smyd5
Mouse Description:
SET and MYND domain containing 5 Gene [Source:MGI Symbol;Acc:MGI:108048]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12338 Nonsense Available for shipment Available now
sa42390 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa12338
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021657 Nonsense 288 415 9 13
ENSDART00000124042   326 453 9 13
Genomic Location (Zv9):
Chromosome 14 (position 23516716)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 22216506
GRCz11 14 22513751
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YTTCCCCGCCAGCAGAGGGAGCAACTGGATGCGTTTATCGACCAGCTTTA[C/A]AAGGACAYCGACAAAGGTCATTTTTCTCATAGACTCCCACCTGTTTACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42390
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021657 Essential Splice Site 368 415 12 13
ENSDART00000124042 Essential Splice Site 406 453 12 13
Genomic Location (Zv9):
Chromosome 14 (position 23521921)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 22221711
GRCz11 14 22518956
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGCTGTCAGCGAGACAGGAGTCGTCATAGCCGGCACAAGATCTTGAGG[T/C]AAACCATTGCAATCTCTTGTTTAAGCATTCTCTGTGAAACTGGCCAGCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link