wu:fk33d07

Ensembl ID:
ENSDARG00000071652
ZFIN ID:
ZDB-GENE-030131-8898
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B0R0L1]
Human Orthologue:
RRP8
Human Description:
ribosomal RNA processing 8, methyltransferase, homolog (yeast) [Source:HGNC Symbol;Acc:29030]
Mouse Orthologue:
Rrp8
Mouse Description:
ribosomal RNA processing 8, methyltransferase, homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:19142

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14445 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14445
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106112 Nonsense 35 533 2 7
Genomic Location (Zv9):
Chromosome 15 (position 14246872)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 15291835
GRCz11 15 15227857
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCTNAAAAAATTATGTTTTAATATCCGAACAGAAAAAAGCTGTKGGTAAA[C/T]AAAGCCTTTTGAGAACCTTGCAAACACTGGGTTCAGTTCCAGACTGGGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link