zgc:171490

Ensembl ID:
ENSDARG00000071643
ZFIN ID:
ZDB-GENE-080204-29
Description:
hypothetical protein LOC558926 [Source:RefSeq peptide;Acc:NP_001107058]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24069 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24069
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106100 Nonsense 18 336 1 5
Genomic Location (Zv9):
Chromosome 22 (position 6486490)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 6532557
GRCz11 22 6562403
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAAATGAAGCTTTCCTATTATTTTCACATATCGATTTGGTGTTTCCTC[A/T]AGTCGACATTAGGTAAGTTCGGACTGTTGTGATACATTTGATTTTATGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link