
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
tgfbi
- Ensembl ID:
- ENSDARG00000071586
- ZFIN ID:
- ZDB-GENE-030131-73
- Description:
- transforming growth factor-beta-induced protein ig-h3 [Source:RefSeq peptide;Acc:NP_878282]
- Human Orthologue:
- TGFBI
- Human Description:
- transforming growth factor, beta-induced, 68kDa [Source:HGNC Symbol;Acc:11771]
- Mouse Orthologue:
- Tgfbi
- Mouse Description:
- transforming growth factor, beta induced Gene [Source:MGI Symbol;Acc:MGI:99959]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa42397 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa39002 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa22487 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa42397
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000105933 | Nonsense | 443 | 677 | 10 | 17 |
ENSDART00000128463 | Nonsense | 456 | 690 | 10 | 17 |
- Genomic Location (Zv9):
- Chromosome 14 (position 27529521)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 14 26222318 GRCz11 14 26520423 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTGCTGAGAAACCACATTCTCAAGGAGAAGTTTTCCTCCAAGAGCCTTTA[T/A]CATGGGCAGGAGTTGGAGACCCTTGGTGGACTGAAACTTAGAGTGTTTGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa39002
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000105933 | Essential Splice Site | 553 | 677 | 12 | 17 |
ENSDART00000128463 | Essential Splice Site | 566 | 690 | 12 | 17 |
- Genomic Location (Zv9):
- Chromosome 14 (position 27524379)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 14 26217176 GRCz11 14 26515281 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AACGCTGCTTTCAGTGCATTGCCGTCCGCTGACCTCAACAAACTCATGAG[T/A]AATGTCTCACCTTGTCAGTCAGTCAGAAAAGCAGACGTTTAGTGCATGAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa22487
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000105933 | Essential Splice Site | 628 | 677 | 14 | 17 |
ENSDART00000128463 | Essential Splice Site | 641 | 690 | 14 | 17 |
- Genomic Location (Zv9):
- Chromosome 14 (position 27522010)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 14 26214807 GRCz11 14 26512912 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGCTACCAATGGAGTTGTGCACGCTGTTAATGTCATCATCAAGCCACTGC[G/A]TAAGCCAAGGATTCCTTAAACACTGTGATAAAAGAACTATATTGTTTTAA
- Associated Phenotype:
- Not determined
OMIM
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: