hnf4g

Ensembl ID:
ENSDARG00000071565
ZFIN ID:
ZDB-GENE-060929-100
Description:
hepatocyte nuclear factor 4-gamma [Source:RefSeq peptide;Acc:NP_001068579]
Human Orthologue:
HNF4G
Human Description:
hepatocyte nuclear factor 4, gamma [Source:HGNC Symbol;Acc:5026]
Mouse Orthologue:
Hnf4g
Mouse Description:
hepatocyte nuclear factor 4, gamma Gene [Source:MGI Symbol;Acc:MGI:1353604]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45829 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45829
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066644 Nonsense 290 425 8 10
ENSDART00000078402 Nonsense 309 444 8 10
ENSDART00000144193 Nonsense 323 458 8 10
Genomic Location (Zv9):
Chromosome 24 (position 24258950)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 23505828
GRCz11 24 23651002
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTAAGATCAAGGCGATGCGTTATCAGGTTCAGATGAGCCTGGAAGACTA[C/A]ATTAATGACCGGCAGTATGATTCACGCGGGCGATTCGGGGAGCTTCTACT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Body mass index: Association analyses of 249,796 individuals reveal 18 new loci associated with body mass index. (View Study)
  • Urate levels: Genome-wide association analyses identify 18 new loci associated with serum urate concentrations. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link