ENSDARG00000071551 - Zebrafish Mutation Project

Search Zebrafish Mutation Project

e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457

You can look for mutant lines by browsing a complete list or by searching for a particular gene

NP_956198.1

Ensembl ID:: ENSDARG00000071551
Description:: X-ray repair cross-complementing protein 6 [Source:RefSeq peptide;Acc:NP_956198]
Human Orthologue:: XRCC6
Human Description:: X-ray repair complementing defective repair in Chinese hamster cells 6 [Source:HGNC Symbol;Acc:4055]
Mouse Orthologue:: Xrcc6
Mouse Description:: X-ray repair complementing defective repair in Chinese hamster cells 6 Gene [Source:MGI Symbol;Acc:M

Alleles

There is 1 allele of this gene:

Allele name	Consequence	Status	Availability Estimate
hu2487	Nonsense	Confirmed mutation in F2 line	Unknown

Mutation Details

Allele Name:: hu2487
Current Status:: Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: Unknown
Mutation:: T > A
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000105856		None	409	11	13
ENSDART00000105858	Nonsense	503	610	10	12

Genomic Location (Zv9):

Chromosome 12 (position 19929318)

Other Location(s):

Assembly	Chromosome	Position
GRCz10	12	18781479
GRCz11	12	18903353

KASP Assay ID:

None (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

None

Flanking Sequence:

TCTGGAGGCTTTGGCTCTGGATATGCTTTCACCTGAACCCATTGAGGATT[T/A]GACAAGTATTTCTTGTTGTTTAAAGGGAAAAATTAGTATTTTTTTTATCC

Associated Phenotype:

Normal

Stage	Entity	Quality	Tag
Larval:Day 5 ZFS:0000037	whole organism ZFA:0001094	quality PATO:0000001	normal PATO:0000461

OMIM

OMIM information for XRCC6

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: