si:dkeyp-84a8.8

Ensembl ID:
ENSDARG00000071500
ZFIN ID:
ZDB-GENE-050208-575
Description:
hypothetical protein LOC797099 [Source:RefSeq peptide;Acc:NP_001038831]
Human Orthologue:
C21orf70
Human Description:
chromosome 21 open reading frame 70 [Source:HGNC Symbol;Acc:15811]
Mouse Orthologue:
1810008A18Rik
Mouse Description:
RIKEN cDNA 1810008A18 gene Gene [Source:MGI Symbol;Acc:MGI:1916334]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24104 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa24104
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105776 Essential Splice Site 129 245 3 6
Genomic Location (Zv9):
Chromosome 22 (position 12849048)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 12684978
GRCz11 22 12709755
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAATCGAAGAAAGAAAAAATGAAGGAGCGAAGAGAACGATGGCTCAACAG[T/C]GAGTATATTTCCACAATTTCCTTATTTTGTTTATAGAAAAAAGCATTTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link