zic3

Ensembl ID:
ENSDARG00000071497
ZFIN ID:
ZDB-GENE-030708-2
Description:
zinc finger protein ZIC 3 [Source:RefSeq peptide;Acc:NP_001001950]
Human Orthologue:
ZIC3
Human Description:
Zic family member 3 (odd-paired homolog, Drosophila) [Source:HGNC Symbol;Acc:12874]
Mouse Orthologue:
Zic3
Mouse Description:
zinc finger protein of the cerebellum 3 Gene [Source:MGI Symbol;Acc:MGI:106676]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2746 Nonsense F2 line generated During 2018
sa13365 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa2746
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105761 Nonsense 20 448 1 3
Genomic Location (Zv9):
Chromosome 14 (position 32886188)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 31675995
GRCz11 14 32016309
KASP Assay ID:
554-2770.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTCCTTGATAGCGCTCCTCAGTTCCCGTCACTAGGAGTAGGGGGCTTC[G/T]GAACGCCTAGACACCATGAGTTAGGAAACAGAGACCCTGGGCTGGGACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13365
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105761 Nonsense 345 448 2 3
Genomic Location (Zv9):
Chromosome 14 (position 32884284)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 31674091
GRCz11 14 32014405
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGCTCTCACTTGCAGGTGAGAAGCCATTTAAATGCGAGTTCGATGGCTG[C/A]GACAGGCGATTTGCAAACAGCAGCGACAGGAAAARGCACATGCACGTGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link