zic6

Ensembl ID:
ENSDARG00000071496
ZFIN ID:
ZDB-GENE-061207-1
Description:
zic family member 6 [Source:RefSeq peptide;Acc:NP_001001837]
Human Orthologues:
ZIC1, ZIC2, ZIC3, ZIC4, ZIC5
Human Descriptions:
Zic family member 1 (odd-paired homolog, Drosophila) [Source:HGNC Symbol;Acc:12872]
Zic family member 2 (odd-paired homolog, Drosophila) [Source:HGNC Symbol;Acc:12873]
Zic family member 3 (odd-paired homolog, Drosophila) [Source:HGNC Symbol;Acc:12874]
Zic family member 4 [Source:HGNC Symbol;Acc:20393]
Zic family member 5 (odd-paired homolog, Drosophila) [Source:HGNC Symbol;Acc:20322]
Mouse Orthologues:
Zic1, Zic2, Zic3, Zic4, Zic5
Mouse Descriptions:
zinc finger protein of the cerebellum 1 Gene [Source:MGI Symbol;Acc:MGI:106683]
zinc finger protein of the cerebellum 2 Gene [Source:MGI Symbol;Acc:MGI:106679]
zinc finger protein of the cerebellum 3 Gene [Source:MGI Symbol;Acc:MGI:106676]
zinc finger protein of the cerebellum 4 Gene [Source:MGI Symbol;Acc:MGI:107201]
zinc finger protein of the cerebellum 5 Gene [Source:MGI Symbol;Acc:MGI:1929518]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22509 Nonsense Available for shipment Available now
sa35714 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa22509
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105760 Nonsense 50 525 1 2
Genomic Location (Zv9):
Chromosome 14 (position 32892343)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 31682150
GRCz11 14 32022464
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAGCACATGGGGCACCCCACTGGCAGTTCCTTAAAACTCTGCCCCTCG[C/T]AAAATTTGCGAGACTACCACGAGACGAGGGCCAGTGCATATGTTGACCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35714
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105760 Nonsense 192 525 1 2
Genomic Location (Zv9):
Chromosome 14 (position 32892771)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 31682578
GRCz11 14 32022892
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCCCCAGGGCCAACAGCCAGCAGCTTGTCACCCAGTTCTTGGAGTTCTA[T/A]AAGCCTCTGAATATGGCCATGCAGCGAGGAGGGGGTGACGCCTTCCTCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link