si:dkey-236e20.3

Ensembl ID:
ENSDARG00000071495
ZFIN ID:
ZDB-GENE-060503-722
Description:
hypothetical protein LOC571440 [Source:RefSeq peptide;Acc:NP_001076344]
Mouse Orthologues:
AC107864.2, Sult3a1
Mouse Descriptions:
predicted gene 4794 (Gm4794), mRNA [Source:RefSeq DNA;Acc:NM_001101452]
sulfotransferase family 3A, member 1 Gene [Source:MGI Symbol;Acc:MGI:1931469]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37470 Missense, Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa37470
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Missense, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044069 Missense 5 166 1 5
ENSDART00000105752 Nonsense 130 292 3 6
ENSDART00000142416 Nonsense 137 299 3 6
Genomic Location (Zv9):
Chromosome 22 (position 15470678)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 15298687
GRCz11 22 15325070
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTACTATCAGGTCATCTACGTCATGAGGAACCCCAAAGATGTCATGGTTT[C/A]ATATTTTCATTTTTCCCAAAAAATGAAAGACCTGGATTCTGCCAAGAGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link