ZNF618

Ensembl ID:
ENSDARG00000071469
Description:
zinc finger protein 618 [Source:HGNC Symbol;Acc:29416]
Human Orthologue:
ZNF618
Human Description:
zinc finger protein 618 [Source:HGNC Symbol;Acc:29416]
Mouse Orthologue:
Zfp618
Mouse Description:
zinc fingerprotein 618 Gene [Source:MGI Symbol;Acc:MGI:1919950]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7016 Nonsense Mutation detected in F1 DNA During 2018
sa20595 Nonsense Available for shipment Available now
sa7017 Nonsense Mutation detected in F1 DNA During 2018
sa14269 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7016
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101316 Nonsense 329 827 11 11
Genomic Location (Zv9):
Chromosome 5 (position 73377341)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 69544491
GRCz11 5 70316926
KASP Assay ID:
554-4649.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTGTTCTGCTTTTGCAGAGAACAGATTACTCCCAGAAAAGGAGAGGCAA[C/T]AAGTGGCAGAGCGTTTGCTGCGAGTGATGTRTGTCGACCTYGGCCTTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20595
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101316 Nonsense 436 827 11 11
Genomic Location (Zv9):
Chromosome 5 (position 73377662)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 69544812
GRCz11 5 70317247
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGTCCAGACTCCTGCTATTTGCTAACAGCCTATCAAGTCGAGGGTGTG[C/T]GACTCCGTCGCTATGTGCTAGGACTCAAGGAGGCCTCATTAAGGGAAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7017
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101316 Nonsense 591 827 11 11
Genomic Location (Zv9):
Chromosome 5 (position 73378127)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 69545277
GRCz11 5 70317712
KASP Assay ID:
554-5310.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGCGTACGGCCGCTCGAAGAGCACCGTTCCTCTTCTGCAGGGTCTGAAC[A/T]AGCACCTTCTGGGCACACTGGCGTGTTTGCTGGCGCCGCTGAGACAGGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14269
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101316 Nonsense 783 827 11 11
Genomic Location (Zv9):
Chromosome 5 (position 73378704)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 69545854
GRCz11 5 70318289
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGCTCGGTYATGGACAGGTACCCGCGGCTGTCCCGGTTAGCGCWGTGGT[T/A]GTTGGCTGTGCCCGCAGTGGCYGTGCACGGRGAGTGCATGAGCATCTGCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link