si:dkeyp-70f9.5

Ensembl ID:
ENSDARG00000071468
ZFIN ID:
ZDB-GENE-050208-381
Description:
39S ribosomal protein L54, mitochondrial [Source:UniProtKB/Swiss-Prot;Acc:Q1LXI5]
Human Orthologue:
MRPL54
Human Description:
mitochondrial ribosomal protein L54 [Source:HGNC Symbol;Acc:16685]
Mouse Orthologue:
Mrpl54
Mouse Description:
mitochondrial ribosomal protein L54 Gene [Source:MGI Symbol;Acc:MGI:1913297]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37472 Nonsense Mutation detected in F1 DNA During 2018
sa32394 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37472
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105692 Nonsense 35 135 1 3
Genomic Location (Zv9):
Chromosome 22 (position 15866336)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 15693906
GRCz11 22 15720176
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTTATAATAATCTTTTTTGTAACACGTTTCTCGTCCAGACCCGTAGTTA[T/A]GCTAAGAAACCAGGTATGTTTCCTTTTTGTACAGATTTAATACTATATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32394
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105692 Nonsense 68 135 2 3
Genomic Location (Zv9):
Chromosome 22 (position 15866038)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 15693608
GRCz11 22 15719878
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCTGAAAGGTCCAGAAGTCTGCAAGGATCCAGCAAAGCTTTGCACATA[T/A]GCAGTTGGGGTTAATGTCTTTAAACAAGGTGAAGACCCTACTATTAAACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link