
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:154125
- Ensembl ID:
- ENSDARG00000071463
- ZFIN ID:
- ZDB-GENE-061013-717
- Description:
- hypothetical protein LOC768188 [Source:RefSeq peptide;Acc:NP_001070799]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa44186 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa24552 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa44186
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000105677 | Essential Splice Site | 23 | 426 | 2 | 7 |
- Genomic Location (Zv9):
- Chromosome 24 (position 40050064)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 24 38648804 GRCz11 24 38536675 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTCAGTGTTTTTGGTGCTCATAAAGGAAGACAATGGACAGAAACCAGTAG[G/A]TAAATGAACCCACGTTTCATTTCATACATTGAATGATGAATTGTAAGGAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa24552
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000105677 | Essential Splice Site | 97 | 426 | 4 | 7 |
- Genomic Location (Zv9):
- Chromosome 24 (position 40051549)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 24 38650289 GRCz11 24 38538160 - KASP Assay ID:
- 2261-9046.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCACAATGGTCTGTTCCTCCTGCTGTTTCTCATGATCTCTGTGTCTCTCA[G/A]TGCTGGAGGCTCTTGCTCAGCTCTCCCCATCTGTAGGAGGCTCTGTGATA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: