zgc:154125

Ensembl ID:
ENSDARG00000071463
ZFIN ID:
ZDB-GENE-061013-717
Description:
hypothetical protein LOC768188 [Source:RefSeq peptide;Acc:NP_001070799]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44186 Essential Splice Site Mutation detected in F1 DNA During 2018
sa24552 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa44186
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105677 Essential Splice Site 23 426 2 7
Genomic Location (Zv9):
Chromosome 24 (position 40050064)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 38648804
GRCz11 24 38536675
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAGTGTTTTTGGTGCTCATAAAGGAAGACAATGGACAGAAACCAGTAG[G/A]TAAATGAACCCACGTTTCATTTCATACATTGAATGATGAATTGTAAGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24552
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105677 Essential Splice Site 97 426 4 7
Genomic Location (Zv9):
Chromosome 24 (position 40051549)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 38650289
GRCz11 24 38538160
KASP Assay ID:
2261-9046.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACAATGGTCTGTTCCTCCTGCTGTTTCTCATGATCTCTGTGTCTCTCA[G/A]TGCTGGAGGCTCTTGCTCAGCTCTCCCCATCTGTAGGAGGCTCTGTGATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link