
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:dkey-121a11.3
- Ensembl ID:
- ENSDARG00000071458
- ZFIN ID:
- ZDB-GENE-050208-417
- Description:
- Novel protein [Source:UniProtKB/TrEMBL;Acc:A5PME5]
- Human Orthologue:
- KIAA1614
- Human Description:
- KIAA1614 [Source:HGNC Symbol;Acc:29327]
- Mouse Orthologue:
- BC034090
- Mouse Description:
- cDNA sequence BC034090 Gene [Source:MGI Symbol;Acc:MGI:2672904]
Alleles
There are 5 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa24132 | Nonsense | Available for shipment | Available now |
sa37481 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa24133 | Essential Splice Site, Missense | Available for shipment | Available now |
sa10557 | Nonsense | Available for shipment | Available now |
sa24134 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa24132
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000105667 | Nonsense | 114 | 1060 | 1 | 9 |
ENSDART00000136458 | Nonsense | 114 | 130 | 2 | 2 |
ENSDART00000142454 | None | 747 | None | 7 |
- Genomic Location (Zv9):
- Chromosome 22 (position 16676222)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 16427980 GRCz11 22 16454250 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGCTTGGGGCTCCAGCAGCAGCGATGAAGACGGTGAACCTCGCAAACCCT[T/A]GATGTTCCTCACCCGAGACTCCAATCCAGAACTTGAATATGATCCCATCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa37481
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000105667 | Nonsense | 590 | 1060 | 4 | 9 |
ENSDART00000136458 | None | 130 | None | 2 | |
ENSDART00000142454 | Nonsense | 293 | 747 | 3 | 7 |
- Genomic Location (Zv9):
- Chromosome 22 (position 16686192)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 16437950 GRCz11 22 16464220 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GAACATTTCAGAAGCTAAAGAAGAAGGTTCGAAAATTTGACAGCAAGCGG[G/T]AATCTTTGTATGTAAATGGCCTCAGGACTCCATCACCTCTGGACTGCAAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa24133
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > T
- Consequence:
- Essential Splice Site, Missense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000105667 | Essential Splice Site | 897 | 1060 | 6 | 9 |
ENSDART00000136458 | None | 130 | None | 2 | |
ENSDART00000142454 | Missense | 601 | 747 | 5 | 7 |
- Genomic Location (Zv9):
- Chromosome 22 (position 16690264)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 16442022 GRCz11 22 16468292 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GACACCACCACCAGCTGAAGAAAGCCCCGTCACTGCAGACGATACGACTG[G/T]TTAGCATCTGCCTTAAAATTGGATATGTCTGTTTACATGCTACTAATGAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa10557
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000105667 | None | 1060 | None | 9 | |
ENSDART00000136458 | None | 130 | None | 2 | |
ENSDART00000142454 | Nonsense | 609 | 747 | 5 | 7 |
- Genomic Location (Zv9):
- Chromosome 22 (position 16690290)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 16442048 GRCz11 22 16468318 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CCGTCACTGCAGACGATACGACTGGTTAGCATCTGCCTTAAAATTGKATA[T/A]GTCTGTTTACATGCWACTAATGAACTGTTGGTAGATCATGATGATARTAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa24134
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000105667 | Essential Splice Site | 939 | 1060 | 7 | 9 |
ENSDART00000136458 | None | 130 | None | 2 | |
ENSDART00000142454 | None | 747 | None | 7 |
- Genomic Location (Zv9):
- Chromosome 22 (position 16690502)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 16442260 GRCz11 22 16468530 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCTTCTGCATACACTCCAGGAGAACAACCTTGTAGTCCTGTATTAACCAG[G/A]TACATATTTTATACATTATATAAATTATTAACACTTTGATTTGGTTCATC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: