tdrd5

Ensembl ID:
ENSDARG00000071450
ZFIN ID:
ZDB-GENE-050208-502
Description:
Tudor domain-containing protein 5 [Source:UniProtKB/Swiss-Prot;Acc:Q1L981]
Human Orthologue:
TDRD5
Human Description:
tudor domain containing 5 [Source:HGNC Symbol;Acc:20614]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37486 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa37486
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105651 Nonsense 419 902 8 17
ENSDART00000134798 Nonsense 419 905 8 17
Genomic Location (Zv9):
Chromosome 22 (position 17492586)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 17244344
GRCz11 22 17270614
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGAGTCTGCCTGGGAGCATGAAGAGACAGAGCCGTTGACAGACTCTCAA[G/T]AGTCCGATGCTGAGCTCAGAGTCGCCAATAAAACCATCCATCAGGTTAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link