
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ptprc
- Ensembl ID:
- ENSDARG00000071437
- ZFIN ID:
- ZDB-GENE-050208-585
- Description:
- Novel protein similar to vertebrate protein tyrosine phosphatase receptor type C (PTPRC) [Source:Uni
- Human Orthologue:
- PTPRC
- Human Description:
- protein tyrosine phosphatase, receptor type, C [Source:HGNC Symbol;Acc:9666]
- Mouse Orthologue:
- Ptprc
- Mouse Description:
- protein tyrosine phosphatase, receptor type, C Gene [Source:MGI Symbol;Acc:MGI:97810]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa43851 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa9795 | Nonsense | Available for shipment | Available now |
sa39373 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa39372 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa43851
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000105607 | Nonsense | 677 | 1321 | 21 | 35 |
ENSDART00000137111 | Nonsense | 249 | 893 | 7 | 21 |
ENSDART00000137873 | None | 255 | None | 7 |
- Genomic Location (Zv9):
- Chromosome 22 (position 24723018)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 22981747 GRCz11 22 22996527 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCATTCCCCGAATTTTCAACAATTACACCATCAAGGAGGCGAAGAGACCA[G/T]AAAACCAGTCCAAGAACCGCTATGTTGACATCCTGCCTTGTAAATATCAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa9795
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000105607 | Nonsense | 1059 | 1321 | 31 | 35 |
ENSDART00000137111 | Nonsense | 631 | 893 | 17 | 21 |
ENSDART00000137873 | None | 255 | None | 7 |
- Genomic Location (Zv9):
- Chromosome 22 (position 24707457)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 22966186 GRCz11 22 22980966 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CTCATGCTGTACCAGCAGCAARSTAAAMMAGTTGTTATGCTCACAGACTG[T/A]CAAGAGGACGGCAAGGTATGAACTCCCACARTACCAGASAACAGATAGAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa39373
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000105607 | Nonsense | 1094 | 1321 | 32 | 35 |
ENSDART00000137111 | Nonsense | 666 | 893 | 18 | 21 |
ENSDART00000137873 | None | 255 | None | 7 |
- Genomic Location (Zv9):
- Chromosome 22 (position 24706313)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 22965042 GRCz11 22 22979822 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTCGGAGATATGGAAATCGAGGTGAAAAAGACAGAAAGCTTCCCAACATA[T/A]GTAAAACGTCACCTGGAAATACAATCCACAAAGGTAAGTGGAATATCTGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa39372
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000105607 | Nonsense | 1195 | 1321 | 34 | 35 |
ENSDART00000137111 | Nonsense | 767 | 893 | 20 | 21 |
ENSDART00000137873 | None | 255 | None | 7 |
- Genomic Location (Zv9):
- Chromosome 22 (position 24705529)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 22964258 GRCz11 22 22979038 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTGCTCATTAACAGAAAAGTTGGTTGACGTCTTCCAAGTGGTCAAAAACT[T/A]GCGCAAGGAGAGACAGGGAATGGTGGAAACATTTGTAAGTTTTAATTCTT
- Associated Phenotype:
- Not determined
OMIM
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: