smyhc2

Ensembl ID:
ENSDARG00000071433
ZFIN IDs:
ZDB-GENE-060420-2, ZDB-GENE-070822-12
Description:
slow myosin heavy chain 2 [Source:RefSeq peptide;Acc:NP_001096096]
Human Orthologues:
MYH6, MYH7
Human Descriptions:
myosin, heavy chain 6, cardiac muscle, alpha [Source:HGNC Symbol;Acc:7576]
myosin, heavy chain 7, cardiac muscle, beta [Source:HGNC Symbol;Acc:7577]
Mouse Orthologues:
Myh6, Myh7
Mouse Descriptions:
myosin, heavy polypeptide 6, cardiac muscle, alpha Gene [Source:MGI Symbol;Acc:MGI:97255]
myosin, heavy polypeptide 7, cardiac muscle, beta Gene [Source:MGI Symbol;Acc:MGI:2155600]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11877 Nonsense Available for shipment Available now
sa24570 Nonsense Available for shipment Available now
sa44199 Nonsense Mutation detected in F1 DNA During 2018
sa3257 Essential Splice Site F2 line generated During 2018
sa9100 Essential Splice Site Mutation detected in F1 DNA During 2018
sa44198 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa11877
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056849 Nonsense 18 1939 3 39
ENSDART00000124862 Nonsense 18 169 3 5

The following transcripts of ENSDARG00000071433 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 42283399)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 891910
GRCz10 24 40999078
GRCz11 24 40698872
GRCz11 KZ115969.1 6295
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGGGGATGCTGTGATKGCAGAGTTTGGGCCTGCGGCTCCGTTCTTACGT[A/T]AATCAGATAAGGAGCGTCTGGAGGCCCAAACTCGTCCTTTTGACATGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24570
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056849 Nonsense 372 1939 12 39
ENSDART00000124862   None 169 None 5

The following transcripts of ENSDARG00000071433 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 42276408)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 40992087
GRCz11 24 40691881
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATCATGCACTACGGCAACATGAAGTTCAAGCAGAAGCAGAGAGAGGAA[C/T]AGGCCGAGGCTGATGGCACTGAGGGTCAGAACAATTTGAAACCTCAGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44199
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056849 Nonsense 410 1939 13 39
ENSDART00000124862   None 169 None 5

The following transcripts of ENSDARG00000071433 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 42276191)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 40991870
GRCz11 24 40691664
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACCTCATCAAGGGTTTGTGCCATCCAAGAGTCAAAGTAGGAAATGAGTG[G/A]GTCACCAAAGGACAGAATGTCCAACAGGTAAAGAGACATCACATTATTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3257
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056849 Essential Splice Site 724 1939 18 39
ENSDART00000124862   None 169 None 5

The following transcripts of ENSDARG00000071433 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 42271577)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 40987256
GRCz11 24 40687050
KASP Assay ID:
554-2673.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGAAAGGGCTTCCCCAACAGGATCCTGTATGGAGATTTCAAACAACGG[T/C]TAGTACAAAACCGAATTTATGTCTTGCAAAATAATACTATATGTGACCCS
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9100
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056849 Essential Splice Site 978 1939 23 39
ENSDART00000124862   None 169 None 5

The following transcripts of ENSDARG00000071433 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 42270316)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 40985995
GRCz11 24 40685789
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACATGATGWTGACAATTATAGAATGACTGATTTAATAAAAAACGTCTAC[A/C]GGTTAAGAACCTGACWGAAGAGATGGCAGCTTTGGATGAGATTATCGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44198
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056849 Nonsense 1046 1939 24 39
ENSDART00000124862   None 169 None 5

The following transcripts of ENSDARG00000071433 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 42270015)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 40985694
GRCz11 24 40685488
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATTTTTTGGGACGAATTTTAGCTTGAAGGTTCTTTGGAACAAGAAAAG[A/T]AAATTCGCATGGATCTTGAGAGAGCTAAAAGAAAGCTTGAGGGTGACTTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link