smyhc1

Ensembl ID:
ENSDARG00000071430
ZFIN IDs:
ZDB-GENE-030131-271, ZDB-GENE-030131-271, ZDB-GENE-030131-271
Description:
slow myosin heavy chain 1 [Source:RefSeq peptide;Acc:NP_001018343]
Human Orthologues:
MYH6, MYH7
Human Descriptions:
myosin, heavy chain 6, cardiac muscle, alpha [Source:HGNC Symbol;Acc:7576]
myosin, heavy chain 7, cardiac muscle, beta [Source:HGNC Symbol;Acc:7577]
Mouse Orthologues:
Myh6, Myh7
Mouse Descriptions:
myosin, heavy polypeptide 6, cardiac muscle, alpha Gene [Source:MGI Symbol;Acc:MGI:97255]
myosin, heavy polypeptide 7, cardiac muscle, beta Gene [Source:MGI Symbol;Acc:MGI:2155600]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45841 Nonsense Mutation detected in F1 DNA During 2018
sa30156 Nonsense Mutation detected in F1 DNA During 2018
sa37966 Essential Splice Site Mutation detected in F1 DNA During 2018
sa30155 Essential Splice Site Mutation detected in F1 DNA Unknown
sa12384 Nonsense Available for shipment Available now
sa24569 Nonsense Available for shipment Available now
sa30154 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45841
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004536 Nonsense 321 943 10 21
ENSDART00000045928 Nonsense 321 939 11 21
ENSDART00000056853 Nonsense 321 1939 10 37
Genomic Location (Zv9):
Chromosome 24 (position 42248746)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 40964425
GRCz11 24 40664219
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACCCCTATGATTACTCCTACATCTCCCAAGGAGAGACGCAAGTGGCAT[C/A]GATTGATGATGCCGAAGAGTTGATTGCCACTGACGTTAGTGAAATTCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30156
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004536 Nonsense 438 943 13 21
ENSDART00000045928 Nonsense 437 939 14 21
ENSDART00000056853 Nonsense 438 1939 13 37
Genomic Location (Zv9):
Chromosome 24 (position 42247832)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 40963511
GRCz11 24 40663305
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTACTCGATTGGTGCTCTGGCTAAGTCAGTGTATGAGAAGATGTTCCTCT[G/A]GATGGTTGTGAGAATCAACCAATCCCTGGACACCAAACAGCCTCGCCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37966
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004536 Essential Splice Site 724 943 18 21
ENSDART00000045928 Essential Splice Site 723 939 19 21
ENSDART00000056853 Essential Splice Site 724 1939 18 37
Genomic Location (Zv9):
Chromosome 24 (position 42246513)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 40962192
GRCz11 24 40661986
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTTTAATGCACAAATCACAAAACCTTGTTACTTTTTTACCTCTTGTCA[G/A]ATACCGTATTCTGAACCCATCTGCTAACCCTGAGGGACAATTTATAGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30155
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004536   None 943 None 21
ENSDART00000045928   None 939 None 21
ENSDART00000056853 Essential Splice Site 1327 1939 26 37
Genomic Location (Zv9):
Chromosome 24 (position 42243959)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 40959638
GRCz11 24 40659432
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACTCAGCAGATTGAAGACCTCAAGAGACAGCTAGAGGAGGAAGTCAAG[G/A]TTTGTTGTAATTCATAATGCTTTTTTTTTCTTCTAGAAACTGAATCCGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12384
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004536   None 943 None 21
ENSDART00000045928   None 939 None 21
ENSDART00000056853 Nonsense 1581 1939 31 37
Genomic Location (Zv9):
Chromosome 24 (position 42242729)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 40958408
GRCz11 24 40658202
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCAGTTGGAGTTCAATCAGGTMAAAGCTGACATTGAGCGTAAGCTGTCT[G/T]AGAAAGATGAAGAGATGGAGCAGGCCAAGAGRAACCAGCAGAGAGTGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24569
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004536   None 943 None 21
ENSDART00000045928   None 939 None 21
ENSDART00000056853 Nonsense 1616 1939 31 37
Genomic Location (Zv9):
Chromosome 24 (position 42242624)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 40958303
GRCz11 24 40658097
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCTGCAGAGTTCACTGGAATCAGAGACTCGCAGCAGGAATGAAGCTCTC[A/T]GACTGAAGAAGAAGATGGAGGGAGACCTCAATGAGATGGAGATTCAGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30154
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004536   None 943 None 21
ENSDART00000045928   None 939 None 21
ENSDART00000056853 Nonsense 1659 1939 32 37
Genomic Location (Zv9):
Chromosome 24 (position 42242410)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 40958089
GRCz11 24 40657883
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAGAATAGCATTAATTTGTAAGCTTGTATTTTGTAGGATGCCCAACTG[C/T]AGCTGGATGACGCTCTGCGTGGCAATGATGATCTCAAAGAGAACATCGCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link