tdo2a

Ensembl ID:
ENSDARG00000071429
ZFIN ID:
ZDB-GENE-030131-1187
Description:
Tryptophan 2,3-dioxygenase A [Source:UniProtKB/Swiss-Prot;Acc:A7MBU6]
Human Orthologue:
TDO2
Human Description:
tryptophan 2,3-dioxygenase [Source:HGNC Symbol;Acc:11708]
Mouse Orthologue:
Tdo2
Mouse Description:
tryptophan 2,3-dioxygenase Gene [Source:MGI Symbol;Acc:MGI:1928486]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31999 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31999
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105590 Nonsense 137 406 5 12
Genomic Location (Zv9):
Chromosome 14 (position 38006037)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 36404876
GRCz11 14 36745190
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTCGACTGTTGCTTGACCAGTTCGCTGTTCTGGAAACCATGACGGCCT[T/A]AGACTTCTATGACTTCAGGTAAATAATTTTCATGATTTTTATTTCTAATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link