
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:85752
- Ensembl ID:
- ENSDARG00000071426
- ZFIN ID:
- ZDB-GENE-040426-2547
- Description:
- Leucine-rich repeat-containing protein 59 [Source:UniProtKB/Swiss-Prot;Acc:Q6NWG1]
- Human Orthologue:
- LRRC59
- Human Description:
- leucine rich repeat containing 59 [Source:HGNC Symbol;Acc:28817]
- Mouse Orthologue:
- Lrrc59
- Mouse Description:
- leucine rich repeat containing 59 Gene [Source:MGI Symbol;Acc:MGI:2138133]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa31886 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa31886
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000105584 | Nonsense | 134 | 314 | 5 | 8 |
The following transcripts of ENSDARG00000071426 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 12 (position 33472484)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 31670481 GRCz11 12 31785383 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCTTGGAGCCAACACTGGCCAAGGCAGCAGGCGATTGCTTGGATGAGAAG[C/T]AGTGCAGACAGTGTGCATCCAGGGTGAATGCTGTTACAGTACAGTTAAAC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: