zgc:85752

Ensembl ID:
ENSDARG00000071426
ZFIN ID:
ZDB-GENE-040426-2547
Description:
Leucine-rich repeat-containing protein 59 [Source:UniProtKB/Swiss-Prot;Acc:Q6NWG1]
Human Orthologue:
LRRC59
Human Description:
leucine rich repeat containing 59 [Source:HGNC Symbol;Acc:28817]
Mouse Orthologue:
Lrrc59
Mouse Description:
leucine rich repeat containing 59 Gene [Source:MGI Symbol;Acc:MGI:2138133]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31886 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31886
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105584 Nonsense 134 314 5 8

The following transcripts of ENSDARG00000071426 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 33472484)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 31670481
GRCz11 12 31785383
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTTGGAGCCAACACTGGCCAAGGCAGCAGGCGATTGCTTGGATGAGAAG[C/T]AGTGCAGACAGTGTGCATCCAGGGTGAATGCTGTTACAGTACAGTTAAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link