zgc:153279

Ensembl ID:
ENSDARG00000071419
ZFIN ID:
ZDB-GENE-060929-1106
Description:
ankyrin repeat and SOCS box-containing 10 [Source:RefSeq peptide;Acc:NP_001070616]
Human Orthologue:
ASB10
Human Description:
ankyrin repeat and SOCS box-containing 10 [Source:HGNC Symbol;Acc:17185]
Mouse Orthologue:
Asb10
Mouse Description:
ankyrin repeat and SOCS box-containing 10 Gene [Source:MGI Symbol;Acc:MGI:2152836]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37930 Essential Splice Site Mutation detected in F1 DNA During 2018
sa15096 Nonsense Available for shipment Available now
sa9836 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37930
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105573 Essential Splice Site 188 457 3 5
ENSDART00000140971 Essential Splice Site 189 458 3 5
Genomic Location (Zv9):
Chromosome 24 (position 35451255)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 34214467
GRCz11 24 34100642
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGATCTATTACAGAATGTAATATCCCCAGACTTTTGCTTTGTTTTTCC[A/T]GGTGTGCCAAACATCTCCTCGCATTTGGCGCTTTAATAAACGGGCAAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15096
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105573 Nonsense 360 457 4 5
ENSDART00000140971 Nonsense 361 458 4 5
Genomic Location (Zv9):
Chromosome 24 (position 35446199)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 34219523
GRCz11 24 34105698
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTAATATAACTGMATTTTTTCTCTACCATTTNNNNCWTGCACAGGTGT[T/G]AAAATACTGCTGCTCATCWCCACGWACAATAGAAGTGCTCTTAAACGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9836
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105573 Nonsense 445 457 5 5
ENSDART00000140971 Nonsense 446 458 5 5
Genomic Location (Zv9):
Chromosome 24 (position 35444470)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 34221252
GRCz11 24 34107427
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGGTCGTCTGCACCGGGTCATCCCCAAACTGGGCTTACCAACTTTCCTC[A/T]AAAACTACATAATGCTGGCATTCAGAGACTACATGCACTRAGAGAGAGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link