zgc:91940

Ensembl ID:
ENSDARG00000071414
ZFIN ID:
ZDB-GENE-040718-418
Description:
Uncharacterized protein C17orf62 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q6DGA7]
Human Orthologue:
C17orf62
Human Description:
chromosome 17 open reading frame 62 [Source:HGNC Symbol;Acc:28672]
Mouse Orthologue:
BC017643
Mouse Description:
cDNA sequence BC017643 Gene [Source:MGI Symbol;Acc:MGI:2384959]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42069 Essential Splice Site Mutation detected in F1 DNA During 2018
sa30962 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa42069
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105562 Essential Splice Site 101 206 5 7
ENSDART00000105562 Essential Splice Site 101 206 5 7
Genomic Location (Zv9):
Chromosome 12 (position 34951545)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 33355654
GRCz11 12 33456637
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTCTCTATACCATGTTGTTGACTCTGTGGAAAAGAGGGCACGAGAAAGG[T/C]GAGTTCAGCCTTAGCTGTCATCATTTGTATTTTTTCTTTTGTGAATTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30962
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105562 Essential Splice Site 101 206 5 7
ENSDART00000105562 Essential Splice Site 101 206 5 7
Genomic Location (Zv9):
Chromosome 12 (position 34951545)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 33355654
GRCz11 12 33456637
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTCTCTATACCATGTTGTTGACTCTGTGGAAAAGAGGGCACGAGAAAGG[T/C]GAGTTCAGCCTTAGCTGTCATCATTTGTATTTTTTCTTTTGTGAATTATA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link