
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
Q1LYC1_DANRE
- Ensembl ID:
- ENSDARG00000071357
- Description:
- Novel protein similar to vertebrate mitogen-activated protein kinase kinase kinase kinase 3 (MAP4K3)
- Human Orthologue:
- MAP4K3
- Human Description:
- mitogen-activated protein kinase kinase kinase kinase 3 [Source:HGNC Symbol;Acc:6865]
- Mouse Orthologue:
- Map4k3
- Mouse Description:
- mitogen-activated protein kinase kinase kinase kinase 3 Gene [Source:MGI Symbol;Acc:MGI:2154405]
Alleles
There are 5 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa12892 | Nonsense | Available for shipment | Available now |
sa36410 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa45607 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa36411 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa18499 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa12892
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000093004 | Nonsense | 3 | 864 | 1 | 33 |
- Genomic Location (Zv9):
- Chromosome 17 (position 24460604)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 17 24614046 GRCz11 17 24632447 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GAAAACGTAAATAAACCGGAGGGCGCAAACGGTGACTCGCACGATGAATT[T/A]AAGCTTGGATCTATCGCGCAGAAACCCACAGGAGGACTTTGAGCTGATCC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa36410
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000093004 | Essential Splice Site | 153 | 864 | 7 | 33 |
- Genomic Location (Zv9):
- Chromosome 17 (position 24468971)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 17 24622413 GRCz11 17 24640814 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTGCAGGGTGCAAATATACTGTTAACAGACAACGGCTATGTTAAGCTAGG[T/A]AACAAAACACATTTATTGGAGATCACAGTTATTCAGAAGCACTAACCTTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa45607
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000093004 | Nonsense | 593 | 864 | 25 | 33 |
- Genomic Location (Zv9):
- Chromosome 17 (position 24484658)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 17 24638100 GRCz11 17 24656501 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCATGAAACTCTATACACTTCTATGTGTGTGTTTCACAGGTAAAGCATCT[C/T]AGCTGTACTCCTACAACCTGACGGGGCTCTTTGAACAAGCGCGACAGATG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa36411
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000093004 | Nonsense | 652 | 864 | 27 | 33 |
- Genomic Location (Zv9):
- Chromosome 17 (position 24486353)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 17 24639795 GRCz11 17 24658196 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATACAGTTTAACATGAATTGTTTGTGTATGTATGTAGTGCGAAACCCGTA[C/A]ACAGGTCACAAGTACCTCTGTGGAGCTTTCCAGTCCAGTGTAATGCTGTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa18499
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000093004 | Essential Splice Site | 794 | 864 | 31 | 33 |
- Genomic Location (Zv9):
- Chromosome 17 (position 24488213)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 17 24641655 GRCz11 17 24660056 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGTGGAATTAATYGTTTGCTTWAAATGATAATTATATATGTCCTTTTCAA[G/T]TGTGTCTGCAGGACAGTGTTTTGGCGTTCTGGAAGCATGGAATGCAGGGA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: