mef2bnb

Ensembl ID:
ENSDARG00000071339
ZFIN ID:
ZDB-GENE-050208-757
Description:
UPF0402 protein [Source:UniProtKB/Swiss-Prot;Acc:A3KQI3]
Human Orthologues:
AC002126.5, AC002126.6
Human Description:
UPF0402 protein [Source:UniProtKB/Swiss-Prot;Acc:Q96FH0]
Mouse Orthologue:
2310045N01Rik
Mouse Description:
RIKEN cDNA 2310045N01 gene Gene [Source:MGI Symbol;Acc:MGI:1919618]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45768 Essential Splice Site Mutation detected in F1 DNA During 2018
sa24144 Nonsense Available for shipment Available now
sa6703 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45768
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105432 Essential Splice Site 72 124 4 6
Genomic Location (Zv9):
Chromosome 22 (position 18392572)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 18143507
GRCz11 22 18168485
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAAACTTCACCATACCTCATGACCGTTTCTCTTTGTTGTTGTTTTTTTC[A/T]GTGCGGTTAAAAGTATGACAAACAGTAGTCTCTATTTCAAGAACATAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24144
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105432 Nonsense 107 124 4 6
Genomic Location (Zv9):
Chromosome 22 (position 18392677)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 18143612
GRCz11 22 18168590
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTCCGGCAAGCCATTTCTCTGAAGGAACAGATCAGCAGCTCGCAGGGA[C/T]GAAGGTTGTAATCGCCGTCCATTTGTTTTTGCGCTTTTATAAAATCACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6703
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105432 Nonsense 115 124 5 6
Genomic Location (Zv9):
Chromosome 22 (position 18392837)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 18143772
GRCz11 22 18168750
KASP Assay ID:
554-5373.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCTGTTTTGAAATACGCATGTGGCTTCAGTGCTGTGATTAATCCAAAC[G/T]AAACACCCGCACACACTTCAGTCACACCTTGAATYATGGAAATCATTTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link