
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:dkey-28h18.4
- Ensembl ID:
- ENSDARG00000071325
- ZFIN ID:
- ZDB-GENE-050208-507
- Description:
- Novel protein [Source:UniProtKB/TrEMBL;Acc:Q1LVG8]
- Human Orthologue:
- C19orf26
- Human Description:
- chromosome 19 open reading frame 26 [Source:HGNC Symbol;Acc:28617]
- Mouse Orthologue:
- Dos
- Mouse Description:
- downstream of Stk11 Gene [Source:MGI Symbol;Acc:MGI:1354170]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa16941 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa16941
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000088233 | Nonsense | 337 | 418 | 5 | 6 |
ENSDART00000105399 | Nonsense | 592 | 670 | 13 | 15 |
ENSDART00000132476 | Nonsense | 429 | 582 | 3 | 3 |
ENSDART00000141864 | None | 247 | None | 7 |
- Genomic Location (Zv9):
- Chromosome 22 (position 19048426)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 18799361 GRCz11 22 18824339 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TCTTTTGACCGGTATCGCACTCCACTYCGACRTGGTGAAACTGTCAACTA[T/A]CCTCTAGAAACTAGCTACCAGAGCACGCTCCCACGAATCATTAGTGCACC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: