si:dkey-28h18.4

Ensembl ID:
ENSDARG00000071325
ZFIN ID:
ZDB-GENE-050208-507
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q1LVG8]
Human Orthologue:
C19orf26
Human Description:
chromosome 19 open reading frame 26 [Source:HGNC Symbol;Acc:28617]
Mouse Orthologue:
Dos
Mouse Description:
downstream of Stk11 Gene [Source:MGI Symbol;Acc:MGI:1354170]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16941 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16941
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088233 Nonsense 337 418 5 6
ENSDART00000105399 Nonsense 592 670 13 15
ENSDART00000132476 Nonsense 429 582 3 3
ENSDART00000141864   None 247 None 7
Genomic Location (Zv9):
Chromosome 22 (position 19048426)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 18799361
GRCz11 22 18824339
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTTTGACCGGTATCGCACTCCACTYCGACRTGGTGAAACTGTCAACTA[T/A]CCTCTAGAAACTAGCTACCAGAGCACGCTCCCACGAATCATTAGTGCACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link