zgc:171416

Ensembl ID:
ENSDARG00000071294
ZFIN ID:
ZDB-GENE-041111-230
Description:
NF-kappa-B inhibitor-like protein 2 [Source:UniProtKB/Swiss-Prot;Acc:A9JR78]
Human Orthologue:
NFKBIL2
Human Description:
nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 2 [Source:HGNC Sym
Mouse Orthologue:
Nfkbil2
Mouse Description:
nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 2 Gene [Source:MGI

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10341 Nonsense Available for shipment Available now
sa23005 Nonsense Available for shipment Available now
sa17406 Essential Splice Site Available for shipment Available now
sa32125 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10341
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105326 Nonsense 51 1427 3 28

The following transcripts of ENSDARG00000071294 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 8646701)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 8644043
GRCz11 17 8801223
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAATCAGACTTGTTTCCCTAGGTGACTATCAAGCTGCTATTGAAGAGCAT[C/T]GACAGGAATTAGCGYTGTCTGAGATTTTGCACGATGTGATTGGATCTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23005
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105326 Nonsense 1013 1427 21 28

The following transcripts of ENSDARG00000071294 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 8674673)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 8672015
GRCz11 17 8829195
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACTCGTGTACAGTTGCGTGGTTGTGTGATCAGGCCGCTCAGCGTTATTA[T/A]CAGATGTGTGGACTGCTGCCTCGTCTGTCTCTGCAGAAAGAGGGCGCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17406
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105326 Essential Splice Site 1233 1427 None 28

The following transcripts of ENSDARG00000071294 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 8687675)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 8685017
GRCz11 17 8842197
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCGCGTTTCCTCCAGCAACACCGTCTCCTGTTAGCCAACGCCATGGCCAG[T/G]AAGWRCAKAATTATTAGCCYYTAGGCCAGGGGTGTCCAAACTMGGTCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32125
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105326 Nonsense 1299 1427 26 28

The following transcripts of ENSDARG00000071294 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 8692214)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 8689556
GRCz11 17 8846736
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACAATGTTGACTGATTTTGTTTTTTAGGGGGATTGTCCACTCACACACT[T/A]AAATCTGTCTGGAAATGGACTTACAGACCACAGCATCCTCCTGCTTGCTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link