zgc:165653

Ensembl ID:
ENSDARG00000071292
ZFIN ID:
ZDB-GENE-070620-24
Description:
hypothetical protein LOC100006671 [Source:RefSeq peptide;Acc:NP_001093571]
Human Orthologue:
ACTN4
Human Description:
actinin, alpha 4 [Source:HGNC Symbol;Acc:166]
Mouse Orthologue:
Actn4
Mouse Description:
actinin alpha 4 Gene [Source:MGI Symbol;Acc:MGI:1890773]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42100 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa42100
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050258 Essential Splice Site None 151 10 11
Genomic Location (Zv9):
Chromosome 12 (position 49947735)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 48665040
GRCz11 12 48656217
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTTTCAGATTATTGCTGTTTTTATTGATCCTCTAAACACTCTGAAACA[G/A]CTGCTGGAGTGGATCCGCCGCACCACGCCGTGGCTGGAGAAGCGAGCGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link