si:dkeyp-44b8.8

Ensembl ID:
ENSDARG00000071288
ZFIN ID:
ZDB-GENE-090313-386
Description:
SAM domain and HD domain-containing protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q502K2]
Human Orthologue:
SAMHD1
Human Description:
SAM domain and HD domain 1 [Source:HGNC Symbol;Acc:15925]
Mouse Orthologue:
Samhd1
Mouse Description:
SAM domain and HD domain, 1 Gene [Source:MGI Symbol;Acc:MGI:1927468]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17793 Nonsense Available for shipment Available now
sa24232 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17793
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105316 Nonsense 130 622 4 16
Genomic Location (Zv9):
Chromosome 23 (position 556155)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 527146
GRCz11 23 539939
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTTCATWGACACTCCTCAGTTCCAGCGGCTCCGTCACATTAAGCAGCTC[G/T]GAGGAACCTACCTGGTGTTCCCCGGGGCGTCCCACAACCGATTYGAGCAY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24232
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105316 Nonsense 340 622 10 16
Genomic Location (Zv9):
Chromosome 23 (position 549263)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 520254
GRCz11 23 533047
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTGTTTTTCCTCTGTTTTTGCTCCTCACAGGAAGTTGGCAATCTGTA[T/G]GACATGTTCCACACCCGCAACTGTCTGCATCGCCGGGCGTATCAACACAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link