si:zfos-452g4.1

Ensembl ID:
ENSDARG00000071271
ZFIN ID:
ZDB-GENE-030131-4791
Description:
Wu:fd60e07 protein [Source:UniProtKB/TrEMBL;Acc:Q29RC7]
Human Orthologue:
SAC3D1
Human Description:
SAC3 domain containing 1 [Source:HGNC Symbol;Acc:30179]
Mouse Orthologue:
Sac3d1
Mouse Description:
SAC3 domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1913656]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32428 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32428
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105283 Nonsense 64 386 2 4
Genomic Location (Zv9):
Chromosome 23 (position 12652991)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 12611793
GRCz11 23 12546763
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTGCCTCATGGCTCCTGCATGACGATGTGCCCTGCCTACGAGCTACGG[C/T]AGAGGGAAGCTCAAAGCCGGCTGCACAGGTTTGAGATGCTGCCCGGCACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link