wu:fb99d03

Ensembl ID:
ENSDARG00000071259
ZFIN ID:
ZDB-GENE-030131-2194
Human Orthologue:
FBXO34
Human Description:
F-box protein 34 [Source:HGNC Symbol;Acc:20201]
Mouse Orthologue:
Fbxo34
Mouse Description:
F-box protein 34 Gene [Source:MGI Symbol;Acc:MGI:1926188]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11291 Nonsense Available for shipment Available now
sa19164 Nonsense Mutation detected in F1 DNA During 2018
sa6461 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa11291
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105251 Nonsense 10 652 1 3
ENSDART00000105251 Nonsense 10 652 1 3
Genomic Location (Zv9):
Chromosome 17 (position 10647594)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 10630683
GRCz11 17 10786717
KASP Assay ID:
2261-0692.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCCTTTGTTTAGGTTGAACAACATGCACCTCAAGCCAYACCCTAAACCA[C/T]AAGATAAAGAGATACATCGGGAATCTGTGCGCGATGCAACAYGAGGCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19164
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105251 Nonsense 10 652 1 3
ENSDART00000105251 Nonsense 10 652 1 3
Genomic Location (Zv9):
Chromosome 17 (position 10647594)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 10630683
GRCz11 17 10786717
KASP Assay ID:
2261-0692.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCCTTTGTTTAGGTTGAACAACATGCACCTCAAGCCATACCCTAAACCA[C/T]AAGATAAAGAGATACATCGGGAATCTGTGCGCGATGCAACACGAGGCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6461
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105251 Nonsense 24 652 1 3
Genomic Location (Zv9):
Chromosome 17 (position 10647552)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 10630641
GRCz11 17 10786675
KASP Assay ID:
554-4895.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAAACCACAAGATAAAGAGATACATCGGGAATCTGTGCGCGATGCAACA[C/T]GAGGCCTCCATGCCGACCAGCAGGGAGTACTCAGGAAAGAGTGGGGCGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link