si:dkey-263h23.1

Ensembl ID:
ENSDARG00000071251
ZFIN ID:
ZDB-GENE-060503-350
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q1L912]
Human Orthologue:
KIAA1949
Human Description:
KIAA1949 [Source:HGNC Symbol;Acc:29413]
Mouse Orthologue:
2310014H01Rik
Mouse Description:
RIKEN cDNA 2310014H01 gene Gene [Source:MGI Symbol;Acc:MGI:1923698]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23404 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23404
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105213 Nonsense 414 1319 1 4
ENSDART00000142287   None 419 None 4
Genomic Location (Zv9):
Chromosome 19 (position 805795)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 827282
GRCz11 19 827091
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGGATAAGTGAAGAGCTAGGGAGACGTGAAGACTGGATAGAAAAAGGG[A/T]GAGAACGAGGTAAAAGTAAAGAACGAGGGAAAAGTAAAGAACGAGGGATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link