
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:dkey-263h23.4
- Ensembl ID:
- ENSDARG00000071250
- ZFIN ID:
- ZDB-GENE-060503-538
- Description:
- hypothetical protein LOC796128 [Source:RefSeq peptide;Acc:NP_001103197]
- Human Orthologue:
- TMEM79
- Human Description:
- transmembrane protein 79 [Source:HGNC Symbol;Acc:28196]
- Mouse Orthologue:
- Tmem79
- Mouse Description:
- transmembrane protein 79 Gene [Source:MGI Symbol;Acc:MGI:1919163]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa7242 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa29116 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa7242
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000105212 | Essential Splice Site | None | 333 | 2 | 6 |
ENSDART00000146554 | Essential Splice Site | None | 273 | 2 | 5 |
The following transcripts of ENSDARG00000071250 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 19 (position 771510)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 792997 GRCz11 19 792806 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ACAACAATTGCTGGTTATAATTGAATATTTTACYCCTTGTTGCATTTKCA[G/T]GACCCCTRTGGTRTAAACAAACCCAGAAGAACTGAAGTGCAGACATGATT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa29116
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000105212 | Essential Splice Site | 195 | 333 | 4 | 6 |
ENSDART00000146554 | Essential Splice Site | 199 | 273 | 4 | 5 |
The following transcripts of ENSDARG00000071250 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 19 (position 773120)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 19 794607 GRCz11 19 794416 - KASP Assay ID:
- 2261-2729.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGTCTACACTCTGAGGTGTGCTTTCTTCGCCACCATTCCCATCATCCTGG[G/A]TGAGGACACACACATACACCCTTATACACACACACACTTATTCTTATTCA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: