si:dkey-263h23.4

Ensembl ID:
ENSDARG00000071250
ZFIN ID:
ZDB-GENE-060503-538
Description:
hypothetical protein LOC796128 [Source:RefSeq peptide;Acc:NP_001103197]
Human Orthologue:
TMEM79
Human Description:
transmembrane protein 79 [Source:HGNC Symbol;Acc:28196]
Mouse Orthologue:
Tmem79
Mouse Description:
transmembrane protein 79 Gene [Source:MGI Symbol;Acc:MGI:1919163]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7242 Essential Splice Site Mutation detected in F1 DNA During 2018
sa29116 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa7242
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105212 Essential Splice Site None 333 2 6
ENSDART00000146554 Essential Splice Site None 273 2 5

The following transcripts of ENSDARG00000071250 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 771510)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 792997
GRCz11 19 792806
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAACAATTGCTGGTTATAATTGAATATTTTACYCCTTGTTGCATTTKCA[G/T]GACCCCTRTGGTRTAAACAAACCCAGAAGAACTGAAGTGCAGACATGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29116
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105212 Essential Splice Site 195 333 4 6
ENSDART00000146554 Essential Splice Site 199 273 4 5

The following transcripts of ENSDARG00000071250 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 773120)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 794607
GRCz11 19 794416
KASP Assay ID:
2261-2729.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTCTACACTCTGAGGTGTGCTTTCTTCGCCACCATTCCCATCATCCTGG[G/A]TGAGGACACACACATACACCCTTATACACACACACACTTATTCTTATTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link