zgc:172266

Ensembl ID:
ENSDARG00000071241
ZFIN ID:
ZDB-GENE-080219-13
Description:
hypothetical protein LOC557841 [Source:RefSeq peptide;Acc:NP_001107055]
Human Orthologue:
TRIM35
Human Description:
tripartite motif-containing 35 [Source:HGNC Symbol;Acc:16285]
Mouse Orthologue:
Trim35
Mouse Description:
tripartite motif-containing 35 Gene [Source:MGI Symbol;Acc:MGI:1914104]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3233 Nonsense F2 line generated During 2018

Mutation Details

Allele Name:
sa3233
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082154 Nonsense 381 447 6 6
Genomic Location (Zv9):
Chromosome 23 (position 6984842)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 6939379
GRCz11 23 6873351
KASP Assay ID:
554-3200.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGRAAGGGTTGTGATTTCTTTGACTCGGGTGTGTGGAGTSTGCAGTAC[A/T]GACTGTTTGAAGAGTCTGGTTTTCCAGTTGGGCAGAAGCTGGAGCGGGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link