Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:172266
- Ensembl ID:
- ENSDARG00000071241
- ZFIN ID:
- ZDB-GENE-080219-13
- Description:
- hypothetical protein LOC557841 [Source:RefSeq peptide;Acc:NP_001107055]
- Human Orthologue:
- TRIM35
- Human Description:
- tripartite motif-containing 35 [Source:HGNC Symbol;Acc:16285]
- Mouse Orthologue:
- Trim35
- Mouse Description:
- tripartite motif-containing 35 Gene [Source:MGI Symbol;Acc:MGI:1914104]
Alleles
There is 1 allele of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa3233 | Nonsense | F2 line generated | During 2018 |
Mutation Details
- Allele Name:
- sa3233
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000082154 | Nonsense | 381 | 447 | 6 | 6 |
- Genomic Location (Zv9):
- Chromosome 23 (position 6984842)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 6939379 GRCz11 23 6873351 - KASP Assay ID:
- 554-3200.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGAGRAAGGGTTGTGATTTCTTTGACTCGGGTGTGTGGAGTSTGCAGTAC[A/T]GACTGTTTGAAGAGTCTGGTTTTCCAGTTGGGCAGAAGCTGGAGCGGGTG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
