si:dkey-240e12.1

Ensembl ID:
ENSDARG00000071240
ZFIN ID:
ZDB-GENE-041008-213
Description:
Novel protein similar to vertebrate alanyl-tRNA synthetase like (AARSL) [Source:UniProtKB/TrEMBL;Acc
Human Orthologue:
AARS2
Human Description:
alanyl-tRNA synthetase 2, mitochondrial (putative) [Source:HGNC Symbol;Acc:21022]
Mouse Orthologue:
Aars2
Mouse Description:
alanyl-tRNA synthetase 2, mitochondrial (putative) Gene [Source:MGI Symbol;Acc:MGI:2681839]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43857 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa43857
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084612 Essential Splice Site 329 1022 6 22
ENSDART00000131218 Essential Splice Site 304 997 6 22
Genomic Location (Zv9):
Chromosome 22 (position 26042582)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 25542337
GRCz11 22 25562234
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATAATATTCTGTCTTTAATACCAACATTATCTGTATTGTTTGTGTGTGC[A/T]GTGCTCTAAGGCTCCCGCATATCAGGGCAGAACCGGAGCGGCTGATGTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link