
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:dkey-240e12.1
- Ensembl ID:
- ENSDARG00000071240
- ZFIN ID:
- ZDB-GENE-041008-213
- Description:
- Novel protein similar to vertebrate alanyl-tRNA synthetase like (AARSL) [Source:UniProtKB/TrEMBL;Acc
- Human Orthologue:
- AARS2
- Human Description:
- alanyl-tRNA synthetase 2, mitochondrial (putative) [Source:HGNC Symbol;Acc:21022]
- Mouse Orthologue:
- Aars2
- Mouse Description:
- alanyl-tRNA synthetase 2, mitochondrial (putative) Gene [Source:MGI Symbol;Acc:MGI:2681839]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa43857 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa43857
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000084612 | Essential Splice Site | 329 | 1022 | 6 | 22 |
ENSDART00000131218 | Essential Splice Site | 304 | 997 | 6 | 22 |
- Genomic Location (Zv9):
- Chromosome 22 (position 26042582)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 25542337 GRCz11 22 25562234 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AATAATATTCTGTCTTTAATACCAACATTATCTGTATTGTTTGTGTGTGC[A/T]GTGCTCTAAGGCTCCCGCATATCAGGGCAGAACCGGAGCGGCTGATGTGG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: