zgc:158445

Ensembl ID:
ENSDARG00000071223
ZFIN IDs:
ZDB-GENE-060503-760, ZDB-GENE-061215-78, ZDB-GENE-061215-78
Description:
hypothetical protein LOC798069 [Source:RefSeq peptide;Acc:NP_001073540]
Human Orthologue:
ENDOD1
Human Description:
endonuclease domain containing 1 [Source:HGNC Symbol;Acc:29129]
Mouse Orthologue:
Endod1
Mouse Description:
endonuclease domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1919196]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36760 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa36760
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105167 Essential Splice Site 150 307 2 2
ENSDART00000142222 Essential Splice Site 104 255 2 2
Genomic Location (Zv9):
Chromosome 19 (position 3806286)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 3302859
GRCz11 19 3243757
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTTTACAGTGTGTATTGACCGTTTCTCTCTTTAATCATGTGTTTTGTA[G/A]CTTCAAGACGCTCAAGCTAAAAATGAAGACTACAGACAGTCAAACAAGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link