zgc:73230

Ensembl ID:
ENSDARG00000071219
ZFIN ID:
ZDB-GENE-040426-1978
Description:
hypothetical protein LOC406311 [Source:RefSeq peptide;Acc:NP_998203]
Human Orthologues:
PIK3R1, PIK3R2, PIK3R3
Human Descriptions:
phosphoinositide-3-kinase, regulatory subunit 1 (alpha) [Source:HGNC Symbol;Acc:8979]
phosphoinositide-3-kinase, regulatory subunit 2 (beta) [Source:HGNC Symbol;Acc:8980]
phosphoinositide-3-kinase, regulatory subunit 3 (gamma) [Source:HGNC Symbol;Acc:8981]
Mouse Orthologues:
Pik3r1, Pik3r2, Pik3r3
Mouse Descriptions:
phosphatidylinositol 3 kinase, regulatory subunit, polypeptide 3 (p55) Gene [Source:MGI Symbol;Acc:M
phosphatidylinositol 3-kinase, regulatory subunit, polypeptide 1 (p85 alpha) Gene [Source:MGI Symbol
phosphatidylinositol 3-kinase, regulatory subunit, polypeptide 2 (p85 beta) Gene [Source:MGI Symbol;

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12591 Nonsense Available for shipment Available now
sa32828 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa12591
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126431 Nonsense 92 321 3 8
Genomic Location (Zv9):
Chromosome 2 (position 3552451)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 3131820
GRCz11 2 2973709
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACGAACAAACTCATCCGGATCCTCCAWCAGGAGGGCAAATTTGGATTCT[C/A]GGAGCCTCTGACKTTCAGCTCAGTGCCGGAGCTGATCTCTTTCKACAGGM
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32828
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126431 Essential Splice Site 173 321 4 8
Genomic Location (Zv9):
Chromosome 2 (position 3554108)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 3133477
GRCz11 2 2975366
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACGGCAGAGTATGACCAGCTCTACGATACTTGCACTTCGTTATTAAAGG[T/A]GAGCGAAGGAAAATACTTTGTATAATAATGTTTGAAATTTATTCAGTGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link