wnt4a

Ensembl ID:
ENSDARG00000071208
ZFIN ID:
ZDB-GENE-980526-352
Description:
Protein Wnt-4a [Source:UniProtKB/Swiss-Prot;Acc:P47793]
Human Orthologue:
WNT4
Human Description:
wingless-type MMTV integration site family, member 4 [Source:HGNC Symbol;Acc:12783]
Mouse Orthologue:
Wnt4
Mouse Description:
wingless-related MMTV integration site 4 Gene [Source:MGI Symbol;Acc:MGI:98957]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14222 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14222
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105133 Essential Splice Site 105 352 2 5
Genomic Location (Zv9):
Chromosome 11 (position 40408092)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 38912491
GRCz11 11 39174445
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTCCACGCTGGAGAGCGTTCCTGTGTTTGGGAAAGTGGTCACRCAAGG[T/G]TAGTAGAATTAGAAACAGGACAGGAASCAAAACAACAATAAGSTTAAACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link