slc12a10.2

Ensembl ID:
ENSDARG00000071173
ZFIN ID:
ZDB-GENE-060503-425
Description:
solute carrier family 12 (sodium/potassium/chloride transporters), member 10.2 [Source:RefSeq pepti
Human Orthologue:
SLC12A3
Human Description:
solute carrier family 12 (sodium/chloride transporters), member 3 [Source:HGNC Symbol;Acc:10912]
Mouse Orthologue:
Slc12a3
Mouse Description:
solute carrier family 12, member 3 Gene [Source:MGI Symbol;Acc:MGI:108114]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20849 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20849
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042061 Nonsense 423 998 11 26
Genomic Location (Zv9):
Chromosome 7 (position 4528641)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 4218954
GRCz11 7 4356980
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACTAACTACTTATTTATTTGTATCAGATTCTTACCGTTGTGTCAGGATG[G/A]GGCATTCTGATCACTATTGGGACCTTTGCTGCAACCTTGTCATCAGCGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • HDL cholesterol: Polymorphism in the CETP gene region, HDL cholesterol, and risk of future myocardial infarction: Genomewide analysis among 18 245 initially healthy women from the Women's Genome Health Study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link