zgc:112392

Ensembl ID:
ENSDARG00000071159
ZFIN ID:
ZDB-GENE-050522-336
Description:
hypothetical protein LOC553724 [Source:RefSeq peptide;Acc:NP_001018531]
Human Orthologue:
SFT2D2
Human Description:
SFT2 domain containing 2 [Source:HGNC Symbol;Acc:25140]
Mouse Orthologue:
Sft2d2
Mouse Description:
SFT2 domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1917362]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16504 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16504
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104996 Essential Splice Site 80 161 3 9
Genomic Location (Zv9):
Chromosome 6 (position 8606778)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 8957161
GRCz11 6 9192700
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACTGTTTGCAGTCTTTTACAGTTTAGGTAACATTGCTTCTCTTCTGAGG[T/C]GAGYCATGGAGCTTTATCTAGCTACCTTTGATARATTTCACMCAAAGGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link