
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:112392
- Ensembl ID:
- ENSDARG00000071159
- ZFIN ID:
- ZDB-GENE-050522-336
- Description:
- hypothetical protein LOC553724 [Source:RefSeq peptide;Acc:NP_001018531]
- Human Orthologue:
- SFT2D2
- Human Description:
- SFT2 domain containing 2 [Source:HGNC Symbol;Acc:25140]
- Mouse Orthologue:
- Sft2d2
- Mouse Description:
- SFT2 domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1917362]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa16504 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa16504
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000104996 | Essential Splice Site | 80 | 161 | 3 | 9 |
- Genomic Location (Zv9):
- Chromosome 6 (position 8606778)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 8957161 GRCz11 6 9192700 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CACTGTTTGCAGTCTTTTACAGTTTAGGTAACATTGCTTCTCTTCTGAGG[T/C]GAGYCATGGAGCTTTATCTAGCTACCTTTGATARATTTCACMCAAAGGTG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: