zgc:153257

Ensembl ID:
ENSDARG00000071152
ZFIN ID:
ZDB-GENE-061013-283
Description:
PRKCA-binding protein [Source:RefSeq peptide;Acc:NP_001070804]
Human Orthologue:
PICK1
Human Description:
protein interacting with PRKCA 1 [Source:HGNC Symbol;Acc:9394]
Mouse Orthologue:
Pick1
Mouse Description:
protein interacting with C kinase 1 Gene [Source:MGI Symbol;Acc:MGI:894645]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17409 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17409
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104977 Essential Splice Site 94 406 4 13
ENSDART00000127950 Essential Splice Site 94 406 3 13
Genomic Location (Zv9):
Chromosome 3 (position 4151165)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 3930824
GRCz11 3 3617686
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAGGGGAAAACTAAAGTAGAGGTGGCCAAGATGATCCAGGCTGTGCAGG[T/C]ACAACACAMACACAANNACACACTTTACTGCAGCGCCGCATTTGACACAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link