zgc:112023

Ensembl ID:
ENSDARG00000071149
ZFIN ID:
ZDB-GENE-050417-162
Description:
PI-PLC X domain-containing protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q567I4]
Human Orthologue:
PLCXD1
Human Description:
phosphatidylinositol-specific phospholipase C, X domain containing 1 [Source:HGNC Symbol;Acc:23148]
Mouse Orthologue:
Plcxd1
Mouse Description:
phosphatidylinositol-specific phospholipase C, X domain containing 1 Gene [Source:MGI Symbol;Acc:MGI

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38539 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa38539
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104979 Nonsense 127 309 4 6
Genomic Location (Zv9):
Chromosome 6 (position 8631262)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 8928931
GRCz11 6 9164470
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTTTGGTTTTGTTTTATTTTAAGGAAGCACTGACAGAAGTTGTACGTTG[G/A]TTAGATCAACACATTAAGGAAGTGGTCATCATTGCACTTTCTAATTTTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link