zgc:77395

Ensembl ID:
ENSDARG00000071116
ZFIN ID:
ZDB-GENE-040426-1831
Description:
Endonuclease/exonuclease/phosphatase family domain-containing protein 1 [Source:UniProtKB/Swiss-Prot
Human Orthologue:
EEPD1
Human Description:
endonuclease/exonuclease/phosphatase family domain containing 1 [Source:HGNC Symbol;Acc:22223]
Mouse Orthologue:
Eepd1
Mouse Description:
endonuclease/exonuclease/phosphatase family domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1914

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32236 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa32236
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104933 Essential Splice Site 332 550 3 7
Genomic Location (Zv9):
Chromosome 19 (position 11771023)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 11362775
GRCz11 19 11280773
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGTGGAAATGTGCCGTTTCAGAGAAACCCAATGGAGTGTCCAATAGCG[T/C]GAGTTTATGTTCTTCTAGCACATAACACATACACATATGCAAACATTAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)
  • Platelet counts: Duffy-null-associated low neutrophil counts influence HIV-1 susceptibility in high-risk South African black women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link